View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12259_high_4 (Length: 410)
Name: NF12259_high_4
Description: NF12259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12259_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 15 - 255
Target Start/End: Original strand, 4048325 - 4048565
Alignment:
| Q |
15 |
tcactgatttgacccttcttccatgtggtccctctcattctcagttttcacgcaattttatattatttaattgggggcggtaccttggttatagtccaat |
114 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4048325 |
tcactgatttgacccttcttccctgtggtccctctcattctcagttttcacgcaattttatattatttaattgggggcggtaccttggttatagtccaat |
4048424 |
T |
|
| Q |
115 |
tttgtgggacccacttagggtagatgataacgtggcgtgtttctgatgagtagccccatcaccaaagaatctgtcggcagcagagacgtcacgctgttct |
214 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4048425 |
tttgtgggacccacttagggtagattataacgtggcgtgattctgatgagtagccccatcaccaaagaatctgtcggcagcagagacgtcacgctgttct |
4048524 |
T |
|
| Q |
215 |
ttcttacattattacccacacgcaaacatcaacaacacttt |
255 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4048525 |
ttcttacattattacccacacgctaacatcaacaacacttt |
4048565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 317 - 401
Target Start/End: Original strand, 4048627 - 4048711
Alignment:
| Q |
317 |
gaatagtgttggtctttctttctttagttgttctccgtctacctctcgtcgttgtcgatgttgttgtttgtcgttgtccatgtct |
401 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4048627 |
gaatagtgttggtctttctttcattagttgttctccgtctacctctcgtcgttgtcgatgttgttgtttgtcgttgtccatgtct |
4048711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University