View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12259_low_14 (Length: 241)
Name: NF12259_low_14
Description: NF12259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12259_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 32830883 - 32830661
Alignment:
| Q |
1 |
ttggtattaattttttcatgcaagcttctggaaatgatgctgttatatattacagtcctgaagtgtttagagaagctggagttaaaggtgagaagcaact |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32830883 |
ttggtattaattttttcatgcaagcgtctggaaatgatgctgttatatattacagtcctgaagtgtttagagaagctggagttaaaggtgagaagcaact |
32830784 |
T |
|
| Q |
101 |
ttttggtgtcacaatcattatgggaatagcaaagacatgttttgttctattttcagcattggtattagacaaatttggaagaaggcccatgctgttgttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
32830783 |
ttttggtgtcacaatcattatgggaatagcaaagacatgttttgttctattttcagcattggtattagacagatttggaagaaggcccatgttgttgttg |
32830684 |
T |
|
| Q |
201 |
ggctcatcaggtatggcagtgtc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32830683 |
ggctcatcaggtatggcagtgtc |
32830661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 43547086 - 43547138
Alignment:
| Q |
1 |
ttggtattaattttttcatgcaagcttctggaaatgatgctgttatatattac |
53 |
Q |
| |
|
|||| |||||||| ||||||||||| |||||||| ||||| |||||||||||| |
|
|
| T |
43547086 |
ttgggattaatttcttcatgcaagcatctggaaacgatgccgttatatattac |
43547138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University