View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12259_low_3 (Length: 447)

Name: NF12259_low_3
Description: NF12259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12259_low_3
NF12259_low_3
[»] chr1 (8 HSPs)
chr1 (238-442)||(34655003-34655207)
chr1 (227-442)||(39708880-39709095)
chr1 (235-375)||(34118087-34118229)
chr1 (227-372)||(615823-615965)
chr1 (362-429)||(34118010-34118077)
chr1 (336-442)||(26236643-26236749)
chr1 (334-375)||(11407951-11407992)
chr1 (361-442)||(11408001-11408082)
[»] chr5 (15 HSPs)
chr5 (235-429)||(41355413-41355607)
chr5 (242-375)||(7766879-7767012)
chr5 (227-375)||(27169947-27170096)
chr5 (227-371)||(7271893-7272034)
chr5 (227-372)||(6030249-6030391)
chr5 (244-376)||(18697047-18697181)
chr5 (362-442)||(7767022-7767102)
chr5 (362-442)||(18696958-18697038)
chr5 (19-80)||(23259204-23259265)
chr5 (227-372)||(26656827-26656969)
chr5 (227-372)||(26928414-26928556)
chr5 (110-146)||(7766746-7766782)
chr5 (362-442)||(27170106-27170186)
chr5 (110-146)||(41355287-41355323)
chr5 (110-146)||(18697271-18697307)
[»] chr6 (5 HSPs)
chr6 (227-375)||(21881582-21881730)
chr6 (235-374)||(20740694-20740832)
chr6 (362-442)||(21881492-21881572)
chr6 (362-429)||(20740616-20740683)
chr6 (110-146)||(21881813-21881849)
[»] chr2 (14 HSPs)
chr2 (227-375)||(17375392-17375540)
chr2 (235-375)||(1895525-1895665)
chr2 (235-376)||(1551466-1551606)
chr2 (235-376)||(17281812-17281952)
chr2 (323-429)||(3921630-3921736)
chr2 (362-442)||(17375302-17375382)
chr2 (362-429)||(1551615-1551682)
chr2 (362-429)||(17281961-17282028)
chr2 (227-372)||(4869707-4869849)
chr2 (362-429)||(1895448-1895515)
chr2 (227-272)||(34660414-34660459)
chr2 (235-311)||(4140576-4140651)
chr2 (110-140)||(1551331-1551361)
chr2 (110-146)||(17375618-17375654)
[»] chr4 (11 HSPs)
chr4 (227-376)||(23054093-23054242)
chr4 (235-369)||(53202387-53202521)
chr4 (235-376)||(47518318-47518459)
chr4 (362-429)||(47518468-47518535)
chr4 (370-429)||(23054258-23054317)
chr4 (362-426)||(53202307-53202371)
chr4 (311-375)||(6410106-6410171)
chr4 (334-371)||(24957572-24957609)
chr4 (361-442)||(6410016-6410097)
chr4 (110-153)||(47518192-47518235)
chr4 (384-437)||(34227057-34227110)
[»] chr7 (2 HSPs)
chr7 (227-375)||(3302690-3302838)
chr7 (362-426)||(3302616-3302680)
[»] chr8 (5 HSPs)
chr8 (227-373)||(10408942-10409088)
chr8 (227-442)||(5994655-5994893)
chr8 (362-442)||(10408850-10408930)
chr8 (318-374)||(6444151-6444208)
chr8 (361-429)||(6444073-6444141)
[»] chr3 (1 HSPs)
chr3 (317-372)||(18269711-18269766)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 8e-62; HSPs: 8)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 238 - 442
Target Start/End: Complemental strand, 34655207 - 34655003
Alignment:
238 gttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctcttggctatggtg 337  Q
    |||||| ||||||||||||||||||||||||||| || | | |||| |||||||||||| ||||||| |||||||||  |||||||| |||| | |||||    
34655207 gttggttggtttcgtggtgtgtcgttggatgctttccggtgtttgtttggttttcgtgggtctcagactatttgatttgttttctcttttggttgtggtg 34655108  T
338 gaggttatgtttgctcgcaacataggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgttagtctgtg 437  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |||| ||||||| ||||||| || ||||    
34655107 gaggttatgtttgctcgcaacataggtggtgatggatcatatctaggttcgcttatgaaatgttatggttttgatgcatctttgattgtgttggtttgtg 34655008  T
438 ctgct 442  Q
     ||||    
34655007 gtgct 34655003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 227 - 442
Target Start/End: Original strand, 39708880 - 39709095
Alignment:
227 ttggttgggacgttggtgggtttc-gtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctc 325  Q
    |||||| ||||||||||||||||  ||||||||| ||| |||||||| | | | |||| |||||||| ||| ||||  | |||||||||| |||||||||    
39708880 ttggttaggacgttggtgggtttttgtggtgtgttgttagatgcttgtcggtggttgtttggttttc-tgggtctcgaactatttgattcgttttctctc 39708978  T
326 ttggctatggtggaggttatgtttgctcgcaacataggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttg 425  Q
    |||| | ||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||| |||||||||| |||| |||| |||||||||||    
39708979 ttggttgtggtggaggttatgtttgctcgcaatataggtggtgatggatcgtatctgggttcgcttaggaactgttatggttttgatggatctttggttg 39709078  T
426 tgttagtctgtgctgct 442  Q
    |||| || |||| ||||    
39709079 tgttggtttgtggtgct 39709095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 235 - 375
Target Start/End: Complemental strand, 34118229 - 34118087
Alignment:
235 gacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctcttgg--cta 332  Q
    |||||||||||||||| ||||||||||||||||||||||| | | |||| | |||||||||| |||||||||||||||||  |||||||| ||||   |     
34118229 gacgttggtgggtttcatggtgtgtcgttggatgcttgccggtggttgtttagttttcgtggatctcagattatttgatttgttttctctattggttgtg 34118130  T
333 tggtggaggttatgtttgctcgcaacataggtggtgatggatc 375  Q
    |||| ||||||||||||||||||||||||||||||||||||||    
34118129 tggtagaggttatgtttgctcgcaacataggtggtgatggatc 34118087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 227 - 372
Target Start/End: Complemental strand, 615965 - 615823
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctct 326  Q
    |||||||||||||||||||||||||||||||||||||||||||||  | | | |||| |||||||  |||  ||   | |||||||||| ||||||||||    
615965 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttctcggtggttgtttggttttattggagct---actatttgattcgttttctctct 615869  T
327 tggctatggtggaggttatgtttgctcgcaacataggtggtgatgg 372  Q
    ||| | |||||||| ||||||||| |||||||||||||||||||||    
615868 tggttgtggtggagattatgtttgatcgcaacataggtggtgatgg 615823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 362 - 429
Target Start/End: Complemental strand, 34118077 - 34118010
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgtt 429  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||  || |||||||||||||||    
34118077 ggtggtgatggatcatatctaggttcgcttatgaactgttatggtttcagtggatctttggttgtgtt 34118010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 336 - 442
Target Start/End: Original strand, 26236643 - 26236749
Alignment:
336 tggaggttatgtttgctcgcaacataggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgttagtctg 435  Q
    |||||||||||||| |||| ||||||| ||||||||||||| |||| ||||| ||||||| ||||||| | ||||||| ||||||||||| ||| || ||    
26236643 tggaggttatgtttactcgaaacatagatggtgatggatcagatctgggttcacttatgacctgttatgggttcgatggatctttggttgcgttggtttg 26236742  T
436 tgctgct 442  Q
    || ||||    
26236743 tggtgct 26236749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 334 - 375
Target Start/End: Original strand, 11407951 - 11407992
Alignment:
334 ggtggaggttatgtttgctcgcaacataggtggtgatggatc 375  Q
    |||||||||||||||||||||||||||| |||||||||||||    
11407951 ggtggaggttatgtttgctcgcaacataagtggtgatggatc 11407992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 361 - 442
Target Start/End: Original strand, 11408001 - 11408082
Alignment:
361 aggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgttagtctgtgctgct 442  Q
    |||||||||||||||| || | |||| ||||||||  |||||| |||||||  |||||||||||||||| || |||| ||||    
11408001 aggtggtgatggatcagatatgggttagcttatgatatgttatggtttcgacaaatctttggttgtgttggtttgtggtgct 11408082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 103; Significance: 4e-51; HSPs: 15)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 235 - 429
Target Start/End: Original strand, 41355413 - 41355607
Alignment:
235 gacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctcttggctatg 334  Q
    ||||||||||||||| |||||||||||||||||||||||| | | |||| | |||| ||||| ||| ||  |||||||||  ||||||||||||| | ||    
41355413 gacgttggtgggttttgtggtgtgtcgttggatgcttgccggtggttgtttagtttccgtggatcttaggctatttgatttgttttctctcttggttgtg 41355512  T
335 gtggaggttatgtttgctcgcaacataggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgtt 429  Q
    ||||||||||| ||||||||||||||||| |||||||||||||||||| ||||||| |||||||  ||| ||||||||| |||||||||||||||    
41355513 gtggaggttatatttgctcgcaacataggcggtgatggatcatatctatgttcgctcatgaacttatatggtttcgatggatctttggttgtgtt 41355607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 242 - 375
Target Start/End: Original strand, 7766879 - 7767012
Alignment:
242 gtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctcttggctatggtggagg 341  Q
    ||||||||||||||||||||||||||||||||| | | |||| |||||||||||| ||||||| |||||||||  ||||||||||||| | || ||||||    
7766879 gtgggtttcgtggtgtgtcgttggatgcttgccggtggttgtttggttttcgtgggtctcagactatttgatttgttttctctcttggttgtgatggagg 7766978  T
342 ttatgtttgctcgcaacataggtggtgatggatc 375  Q
    ||||||||||||||||||||||||||||| ||||    
7766979 ttatgtttgctcgcaacataggtggtgattgatc 7767012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 227 - 375
Target Start/End: Original strand, 27169947 - 27170096
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcatttt-ctctc 325  Q
    ||||||||||||||||||||||||||||||||| | ||||||||| ||   | |||| |||||||||||| ||||||  |||||||||| |||| |||||    
27169947 ttggttgggacgttggtgggtttcgtggtgtgttgctggatgctttccgatggttgtttggttttcgtgggtctcaggctatttgattcgtttttctctc 27170046  T
326 ttggctatggtggaggttatgtttgctcgcaacataggtggtgatggatc 375  Q
    |||| | |||||||||||||||||||||||||| || |||||||||||||    
27170047 ttggttgtggtggaggttatgtttgctcgcaacgtaagtggtgatggatc 27170096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 227 - 371
Target Start/End: Complemental strand, 7272034 - 7271893
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctct 326  Q
    |||||| ||||||||||||||||| |  |||||||||||||||||| ||| | |||| |||||||  |||  ||   | |||||||||| ||||||||||    
7272034 ttggtttggacgttggtgggtttctttatgtgtcgttggatgcttgtcagtggttgtttggttttattggggct---actatttgattcgttttctctct 7271938  T
327 tggctatggtggaggttatgtttgctcgcaacataggtggtgatg 371  Q
    ||| | |||||||||||||||||||||||||||||||||||||||    
7271937 tggttgtggtggaggttatgtttgctcgcaacataggtggtgatg 7271893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 227 - 372
Target Start/End: Original strand, 6030249 - 6030391
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctct 326  Q
    |||||||||||||||||||||||||||||||||||||||||||||  | | | |||| |||||||  |||  ||   | |||||||||| ||||||||||    
6030249 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttctcggtggttgtttggttttattggaact---actatttgattcgttttctctct 6030345  T
327 tggctatggtggaggttatgtttgctcgcaacataggtggtgatgg 372  Q
    ||| |  |||||| |||||||||| ||| |||||||||||||||||    
6030346 tggttgcggtggatgttatgtttgatcggaacataggtggtgatgg 6030391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 244 - 376
Target Start/End: Complemental strand, 18697181 - 18697047
Alignment:
244 gggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctcttggctatg--gtggagg 341  Q
    ||||||||||||||||||||||||  ||| | | | |||| |||||||||||| ||||||| |||||||||  |||| | | |||| | ||  |||||||    
18697181 gggtttcgtggtgtgtcgttggataattgtcggtggttgtttggttttcgtgggtctcagactatttgatttgttttttatattggttgtgtggtggagg 18697082  T
342 ttatgtttgctcgcaacataggtggtgatggatca 376  Q
    |||||||||| ||||||||||||||||||||||||    
18697081 ttatgtttgcccgcaacataggtggtgatggatca 18697047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 362 - 442
Target Start/End: Original strand, 7767022 - 7767102
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgttagtctgtgctgct 442  Q
    |||||||||||||||||||||||||| |||||||| |||||| ||||||||| ||||||||||||||| || |||| ||||    
7767022 ggtggtgatggatcatatctaggttcacttatgaattgttatggtttcgatggatctttggttgtgttggtttgtggtgct 7767102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 362 - 442
Target Start/End: Complemental strand, 18697038 - 18696958
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgttagtctgtgctgct 442  Q
    |||||||||||||||||||||||||||||||||||||||||| | |||| || ||||||||||||||| || |||| ||||    
18697038 ggtggtgatggatcatatctaggttcgcttatgaactgttatgggttcggtggatctttggttgtgttggtttgtggtgct 18696958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 23259265 - 23259204
Alignment:
19 catgtggttcagtctctattgatatcattttctccttctctgataaataaagacttctcctt 80  Q
    |||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||    
23259265 catgtggttcagtctctattgatatcattttctcctcctctaataaataaagactcctcctt 23259204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 227 - 372
Target Start/End: Complemental strand, 26656969 - 26656827
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctct 326  Q
    ||||||||||| |||||||||| | || |||||||||||||||||| | |   |||| || ||||  |||  ||   | |||||||||| ||||||||||    
26656969 ttggttgggacattggtgggttccttgatgtgtcgttggatgcttgtcggttgttgtttgattttattggggct---actatttgattcgttttctctct 26656873  T
327 tggctatggtggaggttatgtttgctcgcaacataggtggtgatgg 372  Q
    ||| | | ||| ||||||||||||||||||| ||| ||||||||||    
26656872 tggttgttgtgaaggttatgtttgctcgcaatataagtggtgatgg 26656827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 227 - 372
Target Start/End: Complemental strand, 26928556 - 26928414
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctct 326  Q
    ||||||||||| |||||||||| | || |||||||||||||||||| | |   |||| || ||||  |||  ||   | |||||||||| ||||||||||    
26928556 ttggttgggacattggtgggttccttgatgtgtcgttggatgcttgtcggttgttgtttgattttattggggct---actatttgattcgttttctctct 26928460  T
327 tggctatggtggaggttatgtttgctcgcaacataggtggtgatgg 372  Q
    ||| | | ||| ||||||||||||||||||| ||| ||||||||||    
26928459 tggttgttgtgaaggttatgtttgctcgcaatataagtggtgatgg 26928414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 110 - 146
Target Start/End: Original strand, 7766746 - 7766782
Alignment:
110 tggatggtggtgcgacgagggtctttgtcctcggcac 146  Q
    |||||||||||||||||||||||||||||||| ||||    
7766746 tggatggtggtgcgacgagggtctttgtcctccgcac 7766782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 362 - 442
Target Start/End: Original strand, 27170106 - 27170186
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgttagtctgtgctgct 442  Q
    |||||| ||||||||||| | | ||  |||| |||||||||| ||||||||| ||||||||||||||| || |||| ||||    
27170106 ggtggtaatggatcatatttggctttacttacgaactgttatggtttcgatggatctttggttgtgttggtttgtggtgct 27170186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 110 - 146
Target Start/End: Original strand, 41355287 - 41355323
Alignment:
110 tggatggtggtgcgacgagggtctttgtcctcggcac 146  Q
    |||||||||||||||||||||||||||||||| ||||    
41355287 tggatggtggtgcgacgagggtctttgtcctccgcac 41355323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 110 - 146
Target Start/End: Complemental strand, 18697307 - 18697271
Alignment:
110 tggatggtggtgcgacgagggtctttgtcctcggcac 146  Q
    |||||||||||||||||||||||| ||||||| ||||    
18697307 tggatggtggtgcgacgagggtctctgtcctccgcac 18697271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 93; Significance: 4e-45; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 227 - 375
Target Start/End: Complemental strand, 21881730 - 21881582
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctct 326  Q
    ||||||||||| ||||||| ||| |||||||||||||||||||||| | |   |||| |||||||||||||||||||| |||||||||| ||||||||||    
21881730 ttggttgggacattggtggattttgtggtgtgtcgttggatgcttgtcggtcgttgtttggttttcgtggctctcagactatttgattcgttttctctct 21881631  T
327 tggctatggtggaggttatgtttgctcgcaacataggtggtgatggatc 375  Q
    ||||| ||| ||||||||||||||||||||||| |||||||||||||||    
21881630 tggctgtggcggaggttatgtttgctcgcaacaaaggtggtgatggatc 21881582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 235 - 374
Target Start/End: Complemental strand, 20740832 - 20740694
Alignment:
235 gacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctcttggctatg 334  Q
    ||||||||||||||| |||| ||||||||||||||||||  |  ||||| |||||||||||| ||||| | |||||||||  ||||||||||||| | ||    
20740832 gacgttggtgggttttgtgg-gtgtcgttggatgcttgcatgttattgtttggttttcgtgggtctcaaactatttgatttgttttctctcttggttgtg 20740734  T
335 gtggaggttatgtttgctcgcaacataggtggtgatggat 374  Q
    ||||| ||||||||||||||||||||||||||||||||||    
20740733 gtggatgttatgtttgctcgcaacataggtggtgatggat 20740694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 362 - 442
Target Start/End: Complemental strand, 21881572 - 21881492
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgttagtctgtgctgct 442  Q
    |||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |||| || |||| ||||    
21881572 ggtggtgatggatcatatctaggttcgcttatgaactgctatggtttcgatgaatctttggttatgttggtttgtggtgct 21881492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 362 - 429
Target Start/End: Complemental strand, 20740683 - 20740616
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgtt 429  Q
    ||||||||||||||||||||||||||| |||||||||  ||| ||||||||| |||||||||||||||    
20740683 ggtggtgatggatcatatctaggttcggttatgaacttatatggtttcgatggatctttggttgtgtt 20740616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 110 - 146
Target Start/End: Complemental strand, 21881849 - 21881813
Alignment:
110 tggatggtggtgcgacgagggtctttgtcctcggcac 146  Q
    |||||||||||||||||||||||| ||||||| ||||    
21881849 tggatggtggtgcgacgagggtctatgtcctccgcac 21881813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 93; Significance: 4e-45; HSPs: 14)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 227 - 375
Target Start/End: Complemental strand, 17375540 - 17375392
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctct 326  Q
    ||||||| ||||||||||||||||||||||||||||||||||| || | | | |||| |||||||||||||||||| | |||||||||| |||||||| |    
17375540 ttggttgagacgttggtgggtttcgtggtgtgtcgttggatgcctgtcggtggttgtttggttttcgtggctctcacactatttgattcgttttctctat 17375441  T
327 tggctatggtggaggttatgtttgctcgcaacataggtggtgatggatc 375  Q
    ||| | ||||||||||||||||||||| |||||||||||||||||||||    
17375440 tggttgtggtggaggttatgtttgctcacaacataggtggtgatggatc 17375392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 235 - 375
Target Start/End: Complemental strand, 1895665 - 1895525
Alignment:
235 gacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctcttggctatg 334  Q
    ||||||||||| ||| |||||||||||||||||||||| | | | |||| ||||||| |||| ||||||| |||||||||  ||||||||||||| | ||    
1895665 gacgttggtggattttgtggtgtgtcgttggatgcttgtcggtggttgtttggtttttgtgggtctcagactatttgatttcttttctctcttggttgtg 1895566  T
335 gtggaggttatgtttgctcgcaacataggtggtgatggatc 375  Q
    ||||||||||||| |||||||||||||||||||||| ||||    
1895565 gtggaggttatgtctgctcgcaacataggtggtgattgatc 1895525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 235 - 376
Target Start/End: Original strand, 1551466 - 1551606
Alignment:
235 gacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctcttggctatg 334  Q
    ||||||||||||||| ||||  |||||||||||||||||| |  ||||| || ||||||||| ||||||| |||||||||  |||||||| |||| | ||    
1551466 gacgttggtgggttttgtgga-tgtcgttggatgcttgcctgtaattgtttgattttcgtgggtctcagactatttgatttgttttctctattggttgtg 1551564  T
335 gtggaggttatgtttgctcgcaacataggtggtgatggatca 376  Q
    ||||| ||||||||||||||||||||||||||||||||||||    
1551565 gtggatgttatgtttgctcgcaacataggtggtgatggatca 1551606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 235 - 376
Target Start/End: Original strand, 17281812 - 17281952
Alignment:
235 gacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctcttggctatg 334  Q
    ||||||||||||||| ||||||| |||||| |||||| || | | |||| || ||||||| | ||||||| |||||||||  |||||||||||||   ||    
17281812 gacgttggtgggttttgtggtgtatcgttg-atgctttccggtggttgtttgtttttcgtaggtctcagactatttgatttgttttctctcttggtagtg 17281910  T
335 gtggaggttatgtttgctcgcaacataggtggtgatggatca 376  Q
    ||||||||||||||||||||||||||||||||||||||||||    
17281911 gtggaggttatgtttgctcgcaacataggtggtgatggatca 17281952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 323 - 429
Target Start/End: Complemental strand, 3921736 - 3921630
Alignment:
323 ctcttggctatggtggaggttatgtttgctcgcaacataggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttgg 422  Q
    ||||||| | ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||  ||| |||| |||| || |||||    
3921736 ctcttggttgtggtggatgttatgtttgctcgcaacataggtggtgatggatcatatctaagttcgcttatgaacttatatggttttgatggatgtttgg 3921637  T
423 ttgtgtt 429  Q
    |||||||    
3921636 ttgtgtt 3921630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 362 - 442
Target Start/End: Complemental strand, 17375382 - 17375302
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgttagtctgtgctgct 442  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |||| ||||    
17375382 ggtggtgatggatcatatctaggttcgcttatgaactgttatggtttcgatgaatctttggttgtgttggtttgtggtgct 17375302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 362 - 429
Target Start/End: Original strand, 1551615 - 1551682
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgtt 429  Q
    |||||||||||||||| | ||||||||||||||||||  ||||||||||||| |||||||||||||||    
1551615 ggtggtgatggatcatgtataggttcgcttatgaacttatatagtttcgatggatctttggttgtgtt 1551682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 362 - 429
Target Start/End: Original strand, 17281961 - 17282028
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgtt 429  Q
    ||||||||||||||||||||||||| |||||||||||  ||| ||||||||| |||||||||||||||    
17281961 ggtggtgatggatcatatctaggtttgcttatgaacttatatggtttcgatggatctttggttgtgtt 17282028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 227 - 372
Target Start/End: Complemental strand, 4869849 - 4869707
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggtttt--cgtggctctcagattatttgattcattttctct 324  Q
    |||||| ||||||||||| ||||||||||||| ||||||||||||  | | | |||| |||||||  || ||||     | |||||||||| ||||||||    
4869849 ttggttaggacgttggtgcgtttcgtggtgtgacgttggatgcttctcggtggttgtttggttttaccggggct-----actatttgattcgttttctct 4869755  T
325 cttggctatggtggaggttatgtttgctcgcaacataggtggtgatgg 372  Q
    ||||| |  ||||||||||| ||||| | |||||||||||||||||||    
4869754 cttggttgcggtggaggttacgtttgatagcaacataggtggtgatgg 4869707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 362 - 429
Target Start/End: Complemental strand, 1895515 - 1895448
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgtt 429  Q
    ||||||||||  |||||||||||||||||||||||||  ||| ||||||||| |||||||||||||||    
1895515 ggtggtgatgagtcatatctaggttcgcttatgaacttatatggtttcgatggatctttggttgtgtt 1895448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 227 - 272
Target Start/End: Complemental strand, 34660459 - 34660414
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttg 272  Q
    |||||||| |||||||||||||||||| ||||||||||||||||||    
34660459 ttggttggaacgttggtgggtttcgtgatgtgtcgttggatgcttg 34660414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 235 - 311
Target Start/End: Complemental strand, 4140651 - 4140576
Alignment:
235 gacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttg 311  Q
    ||||||||||||||| ||||||| ||||| |||||||||| | | || | |||||||||||| ||||||| ||||||    
4140651 gacgttggtgggttttgtggtgtatcgtt-gatgcttgccggtggttctttggttttcgtgggtctcagactatttg 4140576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 110 - 140
Target Start/End: Original strand, 1551331 - 1551361
Alignment:
110 tggatggtggtgcgacgagggtctttgtcct 140  Q
    |||||||||||||||||||||||||||||||    
1551331 tggatggtggtgcgacgagggtctttgtcct 1551361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 110 - 146
Target Start/End: Complemental strand, 17375654 - 17375618
Alignment:
110 tggatggtggtgcgacgagggtctttgtcctcggcac 146  Q
    |||||||||||||||||||||||| ||||||| ||||    
17375654 tggatggtggtgcgacgagggtctatgtcctccgcac 17375618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 86; Significance: 6e-41; HSPs: 11)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 227 - 376
Target Start/End: Original strand, 23054093 - 23054242
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctct 326  Q
    ||||||| ||||||||||||||| |||| |||| | |||||||||| ||| | |||| |||||||||||| ||| ||| |||||||||  ||||||||||    
23054093 ttggttgagacgttggtgggttttgtggcgtgttgctggatgcttgtcagtggttgtttggttttcgtgggtctgagactatttgatttgttttctctct 23054192  T
327 tggctatggtggaggttatgtttgctcgcaacataggtggtgatggatca 376  Q
    ||| | ||||||||||||||||||||||||||||||||||||||||||||    
23054193 tggttgtggtggaggttatgtttgctcgcaacataggtggtgatggatca 23054242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 235 - 369
Target Start/End: Complemental strand, 53202521 - 53202387
Alignment:
235 gacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctcttggctatg 334  Q
    ||||||||||||||| |||||||||||||||||||||| | | | |||| |||||||||||| ||||| | |||||||||  ||||||||||||| | ||    
53202521 gacgttggtgggttttgtggtgtgtcgttggatgcttgtctgtggttgtttggttttcgtgggtctcaaactatttgatttgttttctctcttggttgtg 53202422  T
335 gtggaggttatgtttgctcgcaacataggtggtga 369  Q
    |||||||||||||||||||||||||||||||||||    
53202421 gtggaggttatgtttgctcgcaacataggtggtga 53202387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 235 - 376
Target Start/End: Original strand, 47518318 - 47518459
Alignment:
235 gacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctcttggctatg 334  Q
    ||||||||| | ||| |||||||||||||||||||||| | | | |||| |||||||| ||| ||||||| |||||||||  ||||||||||  | | ||    
47518318 gacgttggtagattttgtggtgtgtcgttggatgcttgtcggtggttgtttggttttcatgggtctcagactatttgatttgttttctctctatgttgtg 47518417  T
335 gtggaggttatgtttgctcgcaacataggtggtgatggatca 376  Q
    ||||||||||||||||||||||||||||||||||||||||||    
47518418 gtggaggttatgtttgctcgcaacataggtggtgatggatca 47518459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 362 - 429
Target Start/End: Original strand, 47518468 - 47518535
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgtt 429  Q
    |||||||||| ||||||||||||||||||||||||||  ||| ||||||||| |||||||||||||||    
47518468 ggtggtgatgaatcatatctaggttcgcttatgaacttatatggtttcgatggatctttggttgtgtt 47518535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 370 - 429
Target Start/End: Original strand, 23054258 - 23054317
Alignment:
370 tggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgtt 429  Q
    |||||||||||| ||||||||||||||||||||| ||||| ||| |||||||||||||||    
23054258 tggatcatatctcggttcgcttatgaactgttatggtttcaatggatctttggttgtgtt 23054317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 362 - 426
Target Start/End: Complemental strand, 53202371 - 53202307
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgt 426  Q
    |||||||||| ||||||||||| ||||||||||||||  ||| ||||||||| ||||||||||||    
53202371 ggtggtgatgaatcatatctagattcgcttatgaacttatatggtttcgatggatctttggttgt 53202307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 311 - 375
Target Start/End: Complemental strand, 6410171 - 6410106
Alignment:
311 gattcattttctctcttggctatgg-tggaggttatgtttgctcgcaacataggtggtgatggatc 375  Q
    |||||| ||||||||||||   ||| |||||||||||||||||||||| |||||||||||||||||    
6410171 gattcaatttctctcttggtggtggatggaggttatgtttgctcgcaaaataggtggtgatggatc 6410106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 334 - 371
Target Start/End: Original strand, 24957572 - 24957609
Alignment:
334 ggtggaggttatgtttgctcgcaacataggtggtgatg 371  Q
    ||||||||||||||||||||||||||||||||||||||    
24957572 ggtggaggttatgtttgctcgcaacataggtggtgatg 24957609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 361 - 442
Target Start/End: Complemental strand, 6410097 - 6410016
Alignment:
361 aggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgttagtctgtgctgct 442  Q
    |||||| ||| ||||| ||||  |||||||||||| || |||| ||||||||||||||| ||||||||| || |||| ||||    
6410097 aggtggcgatcgatcagatctgagttcgcttatgatctattatggtttcgatgaatcttgggttgtgttggtttgtggtgct 6410016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 110 - 153
Target Start/End: Original strand, 47518192 - 47518235
Alignment:
110 tggatggtggtgcgacgagggtctttgtcctcggcactacaata 153  Q
    ||||||||||||||| |||||||||||||||| |||| ||||||    
47518192 tggatggtggtgcgaagagggtctttgtcctccgcaccacaata 47518235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 34227057 - 34227110
Alignment:
384 gttcgcttatgaactgttatagtttcgatgaatctttggttgtgttagtctgtg 437  Q
    |||||||||||||||  ||| ||||| ||| ||||||||||||||| |||||||    
34227057 gttcgcttatgaacttatatggtttcaatggatctttggttgtgttggtctgtg 34227110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 227 - 375
Target Start/End: Complemental strand, 3302838 - 3302690
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctct 326  Q
    ||||||| ||||||| |||||||||||||||||| ||||||||||    | | |||| |||||||||||| ||||||| |||||||||||||| ||||||    
3302838 ttggttgtgacgttgctgggtttcgtggtgtgtcattggatgcttagtggtggttgtttggttttcgtggatctcagactatttgattcatttcctctct 3302739  T
327 tggctatggtggaggttatgtttgctcgcaacataggtggtgatggatc 375  Q
    ||| | |||||||||||||||||||||||||||||||||||||| ||||    
3302738 tggttgtggtggaggttatgtttgctcgcaacataggtggtgatagatc 3302690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 362 - 426
Target Start/End: Complemental strand, 3302680 - 3302616
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgt 426  Q
    |||||||||  ||||||||||| ||||||||| ||||||||||||||||||| ||||||||||||    
3302680 ggtggtgatacatcatatctagattcgcttattaactgttatagtttcgatggatctttggttgt 3302616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 71; Significance: 5e-32; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 227 - 373
Target Start/End: Complemental strand, 10409088 - 10408942
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctct 326  Q
    ||||||| ||| ||||||||||| ||||||||||||||||||||||   | | || | ||||||| |||| ||||| | |||||||||  || |||||||    
10409088 ttggttgagacattggtgggttttgtggtgtgtcgttggatgcttgttggtggttatttggtttttgtgggtctcaaactatttgattttttctctctct 10408989  T
327 tggctatggtggaggttatgtttgctcgcaacataggtggtgatgga 373  Q
    ||| | |||||||||||||||||||||||||||||||||||||||||    
10408988 tggttgtggtggaggttatgtttgctcgcaacataggtggtgatgga 10408942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 227 - 442
Target Start/End: Complemental strand, 5994893 - 5994655
Alignment:
227 ttggttgggacgttggtgggtttcgtggtgtgtcgttggatgcttgccagcgattgtgtggttttcgtggctctcagattatttgattcattttctctct 326  Q
    |||||||||||||||||||  | |||||||||| |||||||| ||||| | |||||| ||||||||||||  |||| | | |||||||  ||||||||||    
5994893 ttggttgggacgttggtggtgtacgtggtgtgttgttggatggttgccggtgattgtttggttttcgtgggcctcaaactgtttgatttgttttctctct 5994794  T
327 tggctatgg-tggaggttatgtttgctcgcaacata----------------------ggtggtgatggatcatatctaggttcgcttatgaactgttat 403  Q
    ||| | ||| |||| |||||||||||||||||||||                      |||||||||||||||||||| |||||||||||||||||||||    
5994793 tggttgtggatggatgttatgtttgctcgcaacatagtgctaatggatcgatcatgatggtggtgatggatcatatctgggttcgcttatgaactgttat 5994694  T
404 agtttcgatgaatctttggttgtgttagtctgtgctgct 442  Q
     |||| |||| ||||||||||||||| || |||| ||||    
5994693 ggttttgatggatctttggttgtgttggtttgtggtgct 5994655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 362 - 442
Target Start/End: Complemental strand, 10408930 - 10408850
Alignment:
362 ggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgttagtctgtgctgct 442  Q
    ||||||||||||||||||||||||||||||||||  |||||| ||||||||||||||||||||||||| || |||| ||||    
10408930 ggtggtgatggatcatatctaggttcgcttatgatatgttatggtttcgatgaatctttggttgtgttggtttgtggtgct 10408850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 318 - 374
Target Start/End: Complemental strand, 6444208 - 6444151
Alignment:
318 tttctctcttggctatgg-tggaggttatgtttgctcgcaacataggtggtgatggat 374  Q
    |||||||||||| | ||| ||||||||||||||||||||||| |||||||| ||||||    
6444208 tttctctcttggttgtggatggaggttatgtttgctcgcaacttaggtggttatggat 6444151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 361 - 429
Target Start/End: Complemental strand, 6444141 - 6444073
Alignment:
361 aggtggtgatggatcatatctaggttcgcttatgaactgttatagtttcgatgaatctttggttgtgtt 429  Q
    |||||||||||||||| || |  |||||| ||||| ||||||| ||||||| ||||||||| |||||||    
6444141 aggtggtgatggatcagatatgagttcgcctatgagctgttatggtttcgaagaatctttgattgtgtt 6444073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 317 - 372
Target Start/End: Original strand, 18269711 - 18269766
Alignment:
317 ttttctctcttggctatggtggaggttatgtttgctcgcaacataggtggtgatgg 372  Q
    ||||||||||||  |||| |||||||||||| || ||| |||||||||||||||||    
18269711 ttttctctcttgattatgatggaggttatgtctgatcgaaacataggtggtgatgg 18269766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University