View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12260_low_4 (Length: 390)
Name: NF12260_low_4
Description: NF12260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12260_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 14 - 373
Target Start/End: Complemental strand, 2381215 - 2380851
Alignment:
| Q |
14 |
tgtgttaggcagcatatagttgcacgagtatgttggcagggtggtttccggcaagtactctatttctagagtcaatatgtaaatgaggtgagatata--- |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2381215 |
tgtgttaggcagcatatagttgcacgagtatgttggcagggtggtttccggcaagtactctatttctagagtcaatatgtaaatgaggtgagatatatat |
2381116 |
T |
|
| Q |
111 |
-ggtaaagaatagacgcgtagcttttagtgggaaataccattggttttgagtaggcagagtggatgatgatatggcgtcattgctgtgtcaatgtcagat |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2381115 |
aggtaaagaatagacgcgtagctttttgtgggaaataccattggttttgagtaggcagagtggatgatgatatggcgtcattgctgagtcaatgtcagat |
2381016 |
T |
|
| Q |
210 |
gaatcacccagttaggataagtggcttccgtcgtacgcttagggaaatagactccacctatgatttcaccctgactgggtcttggcccactccggaacaa |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2381015 |
gaatcacccagttaggataagtggcttccgtcgtacgcttagggaaatagactccacttatgatttcaccctgattgggtcttggcccactccggaacaa |
2380916 |
T |
|
| Q |
310 |
cgatgatgaagaaaatgactgtattttgtttatggattgtttaa-ttgagcatctaaatagtgat |
373 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
2380915 |
cgttgatgaagaaaatgactgtattttgtttatggattgtttaagttcagcatctaaatagtgat |
2380851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University