View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12261_high_21 (Length: 251)
Name: NF12261_high_21
Description: NF12261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12261_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 11 - 233
Target Start/End: Original strand, 42358452 - 42358674
Alignment:
| Q |
11 |
ggagcagagacggcgcgtgttttggcgaagagaggggcgagggtgattctaccggcgcgtagcatgaaaaatgcggaggaaacaagaggtagaatagtga |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358452 |
ggagcagaaacggcgcgtgttttggcgaagagaggggcgagggtgattctaccggcgcgtagcatgaaaaatgcggaggaaacaagaggtagaatagtga |
42358551 |
T |
 |
| Q |
111 |
cggagtgtcctgaagcggagattatagttatggcacttgatctcagttctctcaattctgttacgaacttcgttactcgttttcattccatcggtttccc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42358552 |
cggagtgtcctgaagcggagattatagttatggcacttgatctcagttctgtcaattctgttacgaacttcgttactcgttttcactccatcggtttccc |
42358651 |
T |
 |
| Q |
211 |
tctcaatctcctcatgtatgtat |
233 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
42358652 |
tctaaatctcctcatgtatgtat |
42358674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University