View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12261_high_23 (Length: 225)

Name: NF12261_high_23
Description: NF12261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12261_high_23
NF12261_high_23
[»] chr4 (1 HSPs)
chr4 (159-207)||(38899333-38899381)
[»] chr1 (1 HSPs)
chr1 (163-206)||(15076418-15076461)
[»] chr5 (1 HSPs)
chr5 (175-206)||(18668311-18668342)


Alignment Details
Target: chr4 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 159 - 207
Target Start/End: Original strand, 38899333 - 38899381
Alignment:
159 tggctgccgagtgatggagaatttgggtttagtcacatttggaattaga 207  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||    
38899333 tggctgccgagtgatgcagaatttgggtttagtcacatttggaattaga 38899381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 206
Target Start/End: Complemental strand, 15076461 - 15076418
Alignment:
163 tgccgagtgatggagaatttgggtttagtcacatttggaattag 206  Q
    |||| |||||| ||||||||||||||||||||||||||||||||    
15076461 tgcctagtgatagagaatttgggtttagtcacatttggaattag 15076418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 206
Target Start/End: Original strand, 18668311 - 18668342
Alignment:
175 gagaatttgggtttagtcacatttggaattag 206  Q
    ||||||||||||||||||||||||||||||||    
18668311 gagaatttgggtttagtcacatttggaattag 18668342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University