View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12261_high_26 (Length: 211)

Name: NF12261_high_26
Description: NF12261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12261_high_26
NF12261_high_26
[»] chr4 (1 HSPs)
chr4 (17-199)||(25104795-25104978)


Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 199
Target Start/End: Complemental strand, 25104978 - 25104795
Alignment:
17 cacaatttttcctgaaagaaagcaatctactggagcatgatcaccctaagttagatgaggcagttattgaatttgaaaatgagcgtgagagtgagac-nn 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||       
25104978 cacaatttttcctgaaagaaagcaatctactggagcatgatcaccctaagttagatgaggcagttattgaatttgaaaatgagagtgagagtgagacaaa 25104879  T
116 nnnnnngaggaaaactacagggtgatggagacatagagacaatgaagaagataaagaataggagaaatacttcattgagcacag 199  Q
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25104878 aaaaaagaggaaaactacagggtgatggagacatagagacaatgaagaagataaagaataggagaaatacttcattgagcacag 25104795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University