View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12261_low_11 (Length: 433)
Name: NF12261_low_11
Description: NF12261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12261_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 284; Significance: 1e-159; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 124 - 419
Target Start/End: Complemental strand, 13579090 - 13578795
Alignment:
| Q |
124 |
gggtttttcaaacgatgaacaaaaaagtgataaatcatgattaccttgatgaattggagagcggagatttcgaattcaaaacaaaacgtcttttctgttt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13579090 |
gggtttttcaaacgatgaacaaaaaagtgttaaatcatgattaccttgatgaattggagagcggagatttcgaattcaaaacaaaacgtctcttctgttt |
13578991 |
T |
 |
| Q |
224 |
agaatctcgatctcgatcaggggtatcttcaacaattagggttgcaagtaacagcgcttcttcatcccaaccagccatagcagcagcagatttgaatctc |
323 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13578990 |
agaatttcgatctcgatcaggggtatcttcaacaattagggttgcaagtaacagcgcttcttcatcccaaccagccatagcagcagcagatttgaatctc |
13578891 |
T |
 |
| Q |
324 |
ggactaataagtgaagccatgttttggctattcgtcgctgttttctttcggatcacggggcttcgtttttgttcatcactttccaccattttcgtc |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13578890 |
ggactaataagtgaagccatgttttggctattcgtcgctgttttctttcggatcacggggcttcgtttttgttcatcactttccaccattttcgtc |
13578795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 13579191 - 13579134
Alignment:
| Q |
18 |
aaatcagatccaaatcaacccaataacaaaactaatgaaatcaaccaaattcttcaaa |
75 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13579191 |
aaattagatgcaaatcaacccaataacaaaactaatgaaatcaaccaaattcttcaaa |
13579134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University