View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12261_low_25 (Length: 225)
Name: NF12261_low_25
Description: NF12261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12261_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 159 - 207
Target Start/End: Original strand, 38899333 - 38899381
Alignment:
| Q |
159 |
tggctgccgagtgatggagaatttgggtttagtcacatttggaattaga |
207 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38899333 |
tggctgccgagtgatgcagaatttgggtttagtcacatttggaattaga |
38899381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 163 - 206
Target Start/End: Complemental strand, 15076461 - 15076418
Alignment:
| Q |
163 |
tgccgagtgatggagaatttgggtttagtcacatttggaattag |
206 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15076461 |
tgcctagtgatagagaatttgggtttagtcacatttggaattag |
15076418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 206
Target Start/End: Original strand, 18668311 - 18668342
Alignment:
| Q |
175 |
gagaatttgggtttagtcacatttggaattag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18668311 |
gagaatttgggtttagtcacatttggaattag |
18668342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University