View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12261_low_27 (Length: 211)
Name: NF12261_low_27
Description: NF12261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12261_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 36354404 - 36354202
Alignment:
| Q |
1 |
atccttgattttctcttcttcacacgttttggtcgacctcgac----agcattgtggcatcttcctattggacaaca-tttagattataacatttttata |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36354404 |
atccttgattttctcttcttcacacgttttggtcgacctcgacgtacagcattgtggcatcctcctattggacaacactttagattataacatttttata |
36354305 |
T |
 |
| Q |
96 |
tccgaaatatccttacttcattaacaggaacaatttccatatctatggcaagatacaacaatagctactatttctgggaatatttttctttcccagttca |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36354304 |
tccgaaatatccttacttcattaacaggaacaatttccatatctatggcaagatacaacaatagctactatttctgggaatatttttctttcccagttca |
36354205 |
T |
 |
| Q |
196 |
tct |
198 |
Q |
| |
|
||| |
|
|
| T |
36354204 |
tct |
36354202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 129 - 198
Target Start/End: Complemental strand, 36355557 - 36355488
Alignment:
| Q |
129 |
tttccatatctatggcaagatacaacaatagctactatttctgggaatatttttctttcccagttcatct |
198 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| | |||||| |||| ||| ||||| ||||||| |
|
|
| T |
36355557 |
tttccatatctatggccagatacaacaatagctactactcttgggaaaatttctctatcccaattcatct |
36355488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University