View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12262_low_4 (Length: 245)
Name: NF12262_low_4
Description: NF12262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12262_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 14 - 83
Target Start/End: Complemental strand, 38385816 - 38385747
Alignment:
| Q |
14 |
cctgtgcagttggcaaattgcaatgtttgcgtagaggaaaacaaacactgcaattgtgatcacaccattg |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38385816 |
cctgtgcagttggcaaattgcaatgtttgcgtagaggaaaacagacactgcaattgtgatcacaccattg |
38385747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 14 - 70
Target Start/End: Complemental strand, 29439035 - 29438979
Alignment:
| Q |
14 |
cctgtgcagttggcaaattgcaatgtttgcgtagaggaaaacaaacactgcaattgt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29439035 |
cctgtgcagttggcaaattgcaatgtttgcgtagaggaaaacaaacactgcaattgt |
29438979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 95 - 184
Target Start/End: Original strand, 34570192 - 34570283
Alignment:
| Q |
95 |
gtgatttggtgtatactagattgatgtatattcaatcaacgcagagtatacat--gaggttttttgatatgatggagctaatctagttcatg |
184 |
Q |
| |
|
||||| |||||| |||| ||| ||||||||||||||||| | | |||||| || |||||||| ||| ||||||||||| | ||||||||| |
|
|
| T |
34570192 |
gtgatctggtgtgtactggatcgatgtatattcaatcaatgtaaagtatatataagaggttttccgatgtgatggagctactatagttcatg |
34570283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University