View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12263_low_2 (Length: 347)
Name: NF12263_low_2
Description: NF12263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12263_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 4e-29; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 233 - 331
Target Start/End: Complemental strand, 34035229 - 34035129
Alignment:
| Q |
233 |
aagatgagttttatttgtttaaattatttaaa--gaatattttggtataatcagcataaaccattttgaatacatgaatgaggtaaaggtaccgtgagat |
330 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||| |||| ||||||||||||||||||||||||||| |||||||||| || |||| |
|
|
| T |
34035229 |
aagatgagttttatttgtttaaattattaaaaaagaatattttggtatgatcaacataaaccattttgaatacatgaatgatgtaaaggtactgtaagat |
34035130 |
T |
 |
| Q |
331 |
g |
331 |
Q |
| |
|
| |
|
|
| T |
34035129 |
g |
34035129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 165 - 211
Target Start/End: Complemental strand, 34035520 - 34035474
Alignment:
| Q |
165 |
ataagcaaagttacaaagaaagcatacatgccatcggactcgaccac |
211 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
34035520 |
ataagcaaaattacaaagaaagcatacacgccatcggactcaaccac |
34035474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 11 - 44
Target Start/End: Complemental strand, 34035649 - 34035616
Alignment:
| Q |
11 |
tatatatagtatagataacaacaaaatctagcaa |
44 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
34035649 |
tatatatagtatagatgacaacaaaatctagcaa |
34035616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University