View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12263_low_3 (Length: 270)
Name: NF12263_low_3
Description: NF12263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12263_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 268
Target Start/End: Original strand, 7906300 - 7906550
Alignment:
| Q |
18 |
tctaccccaagcccaaagatgaccttgggaagtggttgcgagggagtggtagtgaccggcgtggacggtgagaatgtcggaaggaagagatggaattggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906300 |
tctaccccaagcccaaagatgaccttgggaagtggttgcgagggagtggtagtgaccggcgtggacggtgagaatgtcggaaggaagagatggaattggt |
7906399 |
T |
|
| Q |
118 |
gttggttcgtatgcatgtgttcctataccgacggtggttgttggtaaaccgagtgctccgtgggttccgtcgccgaaactcatcaccgtgctcatccatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906400 |
gttggttcgtatgcatgtgttcctataccgacggtggttgttggtaaaccgagtgctccgtgggttccgtcgccgaaactcatcaccgtgctcatccatc |
7906499 |
T |
|
| Q |
218 |
gacgctgaataacaacactttctagcttcagcttccgaaataatctctgtg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7906500 |
gacgctgaataacaacactttctagcttcagcttccgaaataatctctgtg |
7906550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University