View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12265_high_1 (Length: 385)
Name: NF12265_high_1
Description: NF12265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12265_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 16 - 136
Target Start/End: Complemental strand, 8509443 - 8509323
Alignment:
| Q |
16 |
tgtgacctaaaatgtaagtaactgaaattggatgtgtttaaattcttcatctcaggccatgattaaagaagttgctacttactagtcttgtggcccaatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8509443 |
tgtgacctaaaatgtaagtaactgaaattggatgtgtttaaattcttcatctcaggccatgattaaagaagttgctacttattagtcttgtggcccaatt |
8509344 |
T |
 |
| Q |
116 |
cttgtttttgttagttatgag |
136 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8509343 |
cttgtttttgttagttatgag |
8509323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 257 - 339
Target Start/End: Complemental strand, 8509202 - 8509120
Alignment:
| Q |
257 |
caattgcgtaatttaatgatacatgatcttcagttaggatgaagttttcccacctccaaaatcactttgaagttcgtatgagg |
339 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8509202 |
caattgcataatttaatgatacatgatcttcaattaggatgaagttttcccacctccaaaatcactttgaagttcgtatgagg |
8509120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University