View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12265_high_6 (Length: 234)
Name: NF12265_high_6
Description: NF12265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12265_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 72 - 220
Target Start/End: Original strand, 1432456 - 1432604
Alignment:
| Q |
72 |
cttctcacatttgcttcaatgtatagtattatagttagcctagtatttaggtgtatgctactaaggctgtctaatgaaagtcgaaattcaagttactgaa |
171 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1432456 |
cttctcacatttgctttgatgtatagtattatagttagcctagtatttaggtgtatgctactaaggctgtctaatgaaagtcgaggttcaagttactgaa |
1432555 |
T |
|
| Q |
172 |
tattattaaggatgtttgaatctgaatattgcttccttttagcacaggt |
220 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1432556 |
tattattaaggatgtttgaaactgaatattgcttccttttagcacaggt |
1432604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 112 - 149
Target Start/End: Original strand, 1451198 - 1451235
Alignment:
| Q |
112 |
tagtatttaggtgtatgctactaaggctgtctaatgaa |
149 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
1451198 |
tagtatttaggtgtatgctactaaggctgactagtgaa |
1451235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University