View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12265_low_9 (Length: 205)
Name: NF12265_low_9
Description: NF12265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12265_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 7 - 186
Target Start/End: Original strand, 80600 - 80779
Alignment:
| Q |
7 |
agcagaacctgtggccttctcagtggatatggaatgtgttctctgtaacaaccagggatgagtaaacaggtggaaatgatacaaggaaaaggcaaaataa |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
80600 |
agcagaaactgtggccttctcagtggatatggaatgtgttctctgtaacatccagggatgagtaaacaggtggaaatgatacaaggaaaaggcaaaataa |
80699 |
T |
 |
| Q |
107 |
agctgcctcctcaatctaattgcatcaaacatgaaattgcttctgaatccgtgaattttccgaagttcaacacaactgtc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
80700 |
agctgcctcctcaatctaattgcatcaaacatgaaattgcttctgaatccgtgaattttccgaagttcaacacaactgtc |
80779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University