View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12267_high_6 (Length: 259)
Name: NF12267_high_6
Description: NF12267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12267_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 244
Target Start/End: Original strand, 47328 - 47556
Alignment:
| Q |
16 |
cactctgcagttgatttttgcatatagattttatcttgattggaatgtgaaacatattcattacttaccaagagccagggtcgcggtggaagtttgtaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47328 |
cactctgcagttgatttttgcatatagattttatcttgattggaatgtgaaacatattcattacttaccaagagccagggtcgcggtggaagtttgtaat |
47427 |
T |
 |
| Q |
116 |
tgctttctaaccttgactctaaaatatttgtttgacatttatcttgagttgacagtgatagttgttcttgattcttgtccaatgtcgtcctagacttttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47428 |
tgctttctaaccttgactctaaaatatttgtttgacatttatcttgagttgacagtgatagttgttcttgattcttgtccaatgtcgtcctagacttttt |
47527 |
T |
 |
| Q |
216 |
gccagattctttggatccacaattagagc |
244 |
Q |
| |
|
| ||||||||||||||||||||||||||| |
|
|
| T |
47528 |
gtcagattctttggatccacaattagagc |
47556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University