View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12268_high_13 (Length: 275)
Name: NF12268_high_13
Description: NF12268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12268_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 4141565 - 4141325
Alignment:
| Q |
18 |
cttgaaaaaccaatatatgcaactatatttgacattgatcccaatgtcaagacgatttcactaagaagcttggtatgtttatgtcatcataattggtgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4141565 |
cttgaaaaaccaatatatgcaactatatttgacattgatcccaatgtcaagacgatttcactaagaagcttggtatgtttatgtcatcataattggtgtt |
4141466 |
T |
|
| Q |
118 |
cattttttctttatcatatgcttgcaagtttgatatatatgaggtcttaaaatgcagattgaccggtcgattattgagagttttggggatggagggaaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4141465 |
cattttttctttatcatatgcttgcaagtttgatatatatgaggtcttaaaatgcagattgaccggtcgattattgagagttttggagatggagggaaag |
4141366 |
T |
|
| Q |
218 |
ttgtgataacaagtagagtttatcccttattggctatagag |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4141365 |
ttgtgataacaagtagagtttatcccttattggctatagag |
4141325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 154 - 257
Target Start/End: Complemental strand, 4116483 - 4116380
Alignment:
| Q |
154 |
atatgaggtcttaaaatgcagattgaccggtcgattattgagagttttggggatggagggaaagttgtgataacaagtagagtttatcccttattggcta |
253 |
Q |
| |
|
||||||||| |||| |||||||||||| ||| || |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4116483 |
atatgaggtgttaatatgcagattgacaagtccatcattgagagttttggagatggagggaaagctgtgataacaagtagagtttatcccttattggcta |
4116384 |
T |
|
| Q |
254 |
taga |
257 |
Q |
| |
|
|||| |
|
|
| T |
4116383 |
taga |
4116380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 169 - 258
Target Start/End: Complemental strand, 4127431 - 4127342
Alignment:
| Q |
169 |
atgcagattgaccggtcgattattgagagttttggggatggagggaaagttgtgataacaagtagagtttatcccttattggctatagag |
258 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||| | ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4127431 |
atgcagattgaccggtccattattgagagttttggagatggagggaaagcttgcataacaaatagagtttatcccttattggctatagag |
4127342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 32 - 253
Target Start/End: Complemental strand, 4136495 - 4136272
Alignment:
| Q |
32 |
atatgcaactatatttgacattgatcccaatgtcaagacgatttcactaagaagcttggtatgtttatgtcatcataattggtgttcat---tttttctt |
128 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||| || |||||||| ||||||||||||||||| | | |||||| | |||| || | || || |
|
|
| T |
4136495 |
atatgcaactatctttgacattgatcccaatctcaaaacaatttcacttagaagcttggtatgttttttt--tcataa-agttgtttatgtgtgttattt |
4136399 |
T |
|
| Q |
129 |
tatcatatgcttgcaagtttgatatatatgaggtctt--aaaatgcagattgaccggtcgattattgagagttttggggatggagggaaagttgtgataa |
226 |
Q |
| |
|
|| ||||| ||| ||||||||| ||||||||| | | ||||||||||||||||| ||||| ||||||||||| |||||||||| || | |||| |
|
|
| T |
4136398 |
cataatatgaatgctagtttgatacatatgaggtggtggtatatgcagattgaccggtccattatagagagttttggagatggagggagagcttgcataa |
4136299 |
T |
|
| Q |
227 |
caagtagagtttatcccttattggcta |
253 |
Q |
| |
|
||||||||| |||||||||||| |||| |
|
|
| T |
4136298 |
caagtagagcttatcccttatttgcta |
4136272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 99
Target Start/End: Complemental strand, 4127559 - 4127490
Alignment:
| Q |
30 |
atatatgcaactatatttgacattgatcccaatgtcaagacgatttcactaagaagcttggtatgtttat |
99 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| |||| || |||||||| |||||| |||||| ||||| |
|
|
| T |
4127559 |
atatatgcaactatctttgacatagatcccaatctcaaaacaatttcactcagaagcctggtatatttat |
4127490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 138 - 211
Target Start/End: Complemental strand, 4121674 - 4121601
Alignment:
| Q |
138 |
cttgcaagtttgatatatatgaggtcttaaaatgcagattgaccggtcgattattgagagttttggggatggag |
211 |
Q |
| |
|
||||| ||||||||||||||| ||| |||| |||||||| || ||||| | |||||||||||| |||| |||| |
|
|
| T |
4121674 |
cttgctagtttgatatatatggggtgttaatatgcagatcgatcggtctacaattgagagtttttgggagggag |
4121601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University