View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12268_high_15 (Length: 254)
Name: NF12268_high_15
Description: NF12268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12268_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 22 - 244
Target Start/End: Original strand, 7856602 - 7856823
Alignment:
| Q |
22 |
ggtcgtcgtaagtgttccggtccaggtttcttgggttgcagcagtggtggtggggtacgaatctgtttgatttttacctgctgaatctttattcgcccgc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
7856602 |
ggtcgtcgtaagtgttccggtccaggtttcttgggttgcagcagtggtggtggg-tacgaatctgtacgatttttacctgctgaatctttattcagccgc |
7856700 |
T |
|
| Q |
122 |
tgtacaacccctctctttggtgttgttccgttcctgtggtgttctaggtggtttcaagggtgtaccttgcatggtgctggcaatgcataagggagtggtg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7856701 |
tgtacaacccctctctttggtgttgttccgttcctgtggtgttttaggtggtttcaagggtgtaccttgcatggtgctggcgatgcataagggagtggtg |
7856800 |
T |
|
| Q |
222 |
gtgatgtgtggtgccgatctgtg |
244 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7856801 |
gtgatgtgtggtgccgatctgtg |
7856823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University