View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12268_low_9 (Length: 326)
Name: NF12268_low_9
Description: NF12268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12268_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 29094219 - 29094428
Alignment:
| Q |
18 |
cttgttgaccatggatggaaaacccaactttttcctagttcccatgctttctaatagttgaaagatattcttcataggctccctcaaattagcttgtgta |
117 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29094219 |
cttgttgatcatggatggaaaacc-aactttttcctagttcccatgctttctaatagttgaaagatattcttcataggctccctcaaattagcttgtgta |
29094317 |
T |
 |
| Q |
118 |
ctgctttttgaaaaggataactggcttttataaatcgatggcttgtcctaacacctcttcatatagctggaggatatctgtttcaattagtacacccacc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29094318 |
ctgctttttgaaaaggataactggcttttataaatcgatggcttgtcctaacacctcttcatatagctggagg--atctgtttcaattagtacacccacc |
29094415 |
T |
 |
| Q |
218 |
ttcatctatcctg |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29094416 |
ttcatctatcctg |
29094428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 262 - 322
Target Start/End: Original strand, 29094460 - 29094520
Alignment:
| Q |
262 |
ggtgtgcaaagagtaccggagctcctctgcactctttgatttcatggatttcttctctctc |
322 |
Q |
| |
|
|||||||||||||||| |||||| |||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
29094460 |
ggtgtgcaaagagtactggagcttctctacacactttgatttcatggatttcttctctctc |
29094520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University