View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12269_low_8 (Length: 286)
Name: NF12269_low_8
Description: NF12269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12269_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 50658078 - 50657920
Alignment:
| Q |
1 |
aaaacaatgtgttaaaatatcttctcaatagatatgatattattgaggttgggtagctcaattggtctgcgttaaatgatacggagttgaagttgttgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
50658078 |
aaaacaatgtgttaaaatatcttctcgatagacatgatattattggggttgggtagctcaattagtttgcgttaaatgatacggagttgaagttgttgag |
50657979 |
T |
|
| Q |
101 |
tttaaactcggacaaaagagaaaaactgatctaataactataagacatgatattgtttt |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50657978 |
tttaaactcggacaaaagagaaaaactgatctaataactataagacatgatattgtttt |
50657920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University