View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12269_low_9 (Length: 220)

Name: NF12269_low_9
Description: NF12269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12269_low_9
NF12269_low_9
[»] chr3 (1 HSPs)
chr3 (15-103)||(52471642-52471730)


Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 15 - 103
Target Start/End: Complemental strand, 52471730 - 52471642
Alignment:
15 ataatatactctggcttgaaagtgaactaaaatgggaggagggaaatgattgtttttggattagtttaatttaagttcactttttccac 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||    
52471730 ataatatactctggcttgaaagtgaactaaaatgggaggagggaaataattgtgtttggattagtttaatttaagttcactttttccac 52471642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University