View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12271_high_4 (Length: 242)
Name: NF12271_high_4
Description: NF12271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12271_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 28593339 - 28593128
Alignment:
| Q |
1 |
tcagacattcacctttatcacgactgcaagaaaatgttgattgtagggaatttagtttcgtagttatgaggtgagatttagtttgtgaaatctatttcaa |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28593339 |
tcagacaaccacctttatcacgactgcaagaaaatgttgattgtagggaatttaatttcgtagttatgaggtgaaatttagtttgtgaaatctatttcaa |
28593240 |
T |
 |
| Q |
101 |
attgttatatatcttacttgagtttcacctcaataactataagagtgatgagtagtgttattactaatattttatttagtataatatttcatttgagaga |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
28593239 |
attgttatatatcttacttaagtttcacctcaataactataagagtgatgagtagtgttattactgatattttatttagtataatatttaatttgagaga |
28593140 |
T |
 |
| Q |
201 |
ttataagtggcg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
28593139 |
ttataagtggcg |
28593128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University