View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12271_high_5 (Length: 241)
Name: NF12271_high_5
Description: NF12271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12271_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 37941508 - 37941730
Alignment:
| Q |
1 |
ttggcggaatttccaaagatggtacttgtgtttttgagacaagagcagaagaataaccaagagggtacttttgcagtggcttttgtggtgtttgatcatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37941508 |
ttggcggaatttccaaagatggtacttgtgtttttgagacaagagctgaagaataaccaagagggtacttttgcagtggcttttgtggtgtttgatcatg |
37941607 |
T |
|
| Q |
101 |
aattgttcgaaaggtgaaagcttggttttggctgtgcatgttgtatatattattgagaggctgtttaaaatgatcaaatgaagaagatagcaattggttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
37941608 |
aattgttcgaaaggtgaaagcttggttttggctgtgcatgttgtatatattattgagaggctgtttaaaatgatcaactgaagaagatagaaattggttg |
37941707 |
T |
|
| Q |
201 |
tgaatggaagaggatggaggaag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37941708 |
tgaatggaagaggatggaggaag |
37941730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University