View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12272_high_7 (Length: 299)
Name: NF12272_high_7
Description: NF12272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12272_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 7 - 270
Target Start/End: Original strand, 36183091 - 36183354
Alignment:
| Q |
7 |
ggttagtagttagtattccccatcattgtcatattcatcaccaccttatacacctttgccaccttttaaaaacaaatatcatataaatgtccatctcttg |
106 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36183091 |
ggttagtagttagtattctccatcattgtcatattcatcaccaccttatacacctttgccaccttttaaaaacaaatatcatataaatgtccatctcttg |
36183190 |
T |
|
| Q |
107 |
ttataaaatttcagggaatgttcgtccaattattcaatgaaaatacataatgtctaaacattgaaaaatagccttttcaccaaacattgatgagtatatc |
206 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36183191 |
ttataaaatttcagggaatgtttgtccaattattcaatgaaaatacataatgtctaaacattgaaaaatagccttttcaccaaacattgatgagtatatc |
36183290 |
T |
|
| Q |
207 |
taagccagtttcgatttccactttggcatatggtcatatcatgacagttaaacagatcatatct |
270 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36183291 |
taagccagtctcgatttccactttggcatatggtcatatcatgacagttaaacagatcatatct |
36183354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 7 - 77
Target Start/End: Original strand, 36206165 - 36206235
Alignment:
| Q |
7 |
ggttagtagttagtattccccatcattgtcatattcatcaccaccttatacacctttgccaccttttaaaa |
77 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
36206165 |
ggttagtagttagtattctccatcattgtcatattcatctccaacttatacacctttgccaccttttaaaa |
36206235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 204 - 256
Target Start/End: Original strand, 36207604 - 36207655
Alignment:
| Q |
204 |
atctaagccagtttcgatttccactttggcatatggtcatatcatgacagtta |
256 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
36207604 |
atctaagccagactcgatttccacttcggcatat-gtcatatcatgacagtta |
36207655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University