View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12272_high_9 (Length: 241)
Name: NF12272_high_9
Description: NF12272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12272_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 7958153 - 7957931
Alignment:
| Q |
1 |
tttgtgttttgggagtgnnnnnnnggttttggggtgggattgttcaggcaaggaattaagaagagccattaggaaaatagctagaatggaagtagtaagg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7958153 |
tttgtgttttgggagtgttgttttggttttggggtgggattgttcaggcaaggaattaagaagagccattaggaaaatagctagaatggaagtagtaagg |
7958054 |
T |
|
| Q |
101 |
aaaaatgcactctctctttcatgggagggagagaattgaggttaaagaaaaggttggaaaatagcaattccattttcaacaattttttgaaggaatttgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
7958053 |
aaaaatgcactctctctttcatgggagggagagaattgaggttaaagaaaaggttggaaaatagctattccattttcaacaattttttgaaggagtttgt |
7957954 |
T |
|
| Q |
201 |
gtaaatgatacaaatgagagagg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7957953 |
gtaaatgatacaaatgagagagg |
7957931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University