View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12273_high_13 (Length: 201)
Name: NF12273_high_13
Description: NF12273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12273_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 14 - 181
Target Start/End: Complemental strand, 32034232 - 32034064
Alignment:
| Q |
14 |
gagcagagaaccatttgggcaacaatgttcactcttaa-agttttaacttttcatttttatattcgagctcaagatctctgattaaaattgaaagaaatt |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
32034232 |
gagccgagaaccatttgggcaacaatgttcactcttaagagttttaacttttcatttttatattcgagctcaaaatctctgattaaaactgaaagaaatt |
32034133 |
T |
|
| Q |
113 |
ctcaacttttggatgattaatctaaagaaagaactttttaaatctagaagaacaagtacaaatattgtg |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32034132 |
ctcaacttttggatgattaatctaaagaaagaactttttaaatctagaagaacaagtacaaatattgtg |
32034064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University