View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12273_low_14 (Length: 201)

Name: NF12273_low_14
Description: NF12273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12273_low_14
NF12273_low_14
[»] chr1 (1 HSPs)
chr1 (14-181)||(32034064-32034232)


Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 14 - 181
Target Start/End: Complemental strand, 32034232 - 32034064
Alignment:
14 gagcagagaaccatttgggcaacaatgttcactcttaa-agttttaacttttcatttttatattcgagctcaagatctctgattaaaattgaaagaaatt 112  Q
    |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||    
32034232 gagccgagaaccatttgggcaacaatgttcactcttaagagttttaacttttcatttttatattcgagctcaaaatctctgattaaaactgaaagaaatt 32034133  T
113 ctcaacttttggatgattaatctaaagaaagaactttttaaatctagaagaacaagtacaaatattgtg 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32034132 ctcaacttttggatgattaatctaaagaaagaactttttaaatctagaagaacaagtacaaatattgtg 32034064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University