View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12274_low_11 (Length: 326)
Name: NF12274_low_11
Description: NF12274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12274_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 321
Target Start/End: Complemental strand, 45212085 - 45211761
Alignment:
| Q |
1 |
tcgaagttagcctcacacccatgaatctttgatgtaaaacagagatttatgtgaattggcccctcttgcctacatccacggaagcaccttaacaaatata |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45212085 |
tcgaagttagccacacacccatgaatctttgatgtaaaacagagattgatgtgaattggcacctcttgcctacatccacggaagcaccttaacaaatata |
45211986 |
T |
 |
| Q |
101 |
ttcatcatctcaaataaaattaaaagaat----ctatagccgagctcaatatgtatatcactctacaatactcctactcaaaagttgcaagaaatgataa |
196 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45211985 |
ttcatcacctcaaataaaattaaaagaatgaatctatagccgagctcaatatgtatatcactctacaatactcctactcaagagttgcaagaaatgataa |
45211886 |
T |
 |
| Q |
197 |
tatcacatctcagtgatctcctcacacataaaatgatcacacacacattcctctctagacattgttggcgatacatccactcttcacatgatcaaggttg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45211885 |
tatcacatctcagtgatctcctcacacataaaatgatcacacacacattcctctctatacattgttggcgatacatccactcttcacatggtcaaggttg |
45211786 |
T |
 |
| Q |
297 |
gggatgcttcaacttttcacaggtt |
321 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45211785 |
gggatgcttcaacttttcacaggtt |
45211761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 92 - 122
Target Start/End: Complemental strand, 15679903 - 15679873
Alignment:
| Q |
92 |
acaaatatattcatcatctcaaataaaatta |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15679903 |
acaaatatattcatcatctcaaataaaatta |
15679873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University