View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12274_low_14 (Length: 258)
Name: NF12274_low_14
Description: NF12274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12274_low_14 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 336714 - 336457
Alignment:
| Q |
1 |
ataaatgccattaaaaacatgagacgcaaatggatgactagacagaaattttgagcaaaatcatgtgtaccagcacaagaaggtaaatgagctctagatg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
336714 |
ataaatgccattaaaaacatgagatgcaaatgaatgactagacagaaattttgagcaaaatcatgtgtaccagcacaagaaggtaaatgagctctagatg |
336615 |
T |
 |
| Q |
101 |
gaagtttagatggaagtaatgaaaccgtctgatttggattttttgacggacttctattctctgattgattccaatcctcacgtttagtctcgttgttagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
336614 |
gaagtttagatggaagtaatgaaaccgtctgatttggattttttgacggacttctattgtctgattgattccaatcctcacgtttagtctcgttgttagt |
336515 |
T |
 |
| Q |
201 |
atctgaagcaaaataagtgatcaccaattagtaaatgtggaattaaaaagtttcaaac |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
336514 |
atctgaagcaaaataagtgatcaccaattagtaaatgtggaattaaaaagtttcaaac |
336457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 63 - 104
Target Start/End: Complemental strand, 42171934 - 42171893
Alignment:
| Q |
63 |
atgtgtaccagcacaagaaggtaaatgagctctagatggaag |
104 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||| |||||| |
|
|
| T |
42171934 |
atgtgtaccagcaaaagagggtaaatgagctctagctggaag |
42171893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University