View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12274_low_16 (Length: 245)
Name: NF12274_low_16
Description: NF12274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12274_low_16 |
 | |
|
| [»] scaffold0070 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 11 - 134
Target Start/End: Original strand, 35004008 - 35004131
Alignment:
| Q |
11 |
gaacctgtggactatcaataccatcctccgttgttttgagcttgccttgggtctcagggttaattttgctaaaagttgtttaatggggatccatgtggaa |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35004008 |
gaacttgtggactatcaataccatcctccgttgttttgagcttgccttgggtctcagtgttaattttgctaaaagttgtttaatggggatccatgtggaa |
35004107 |
T |
|
| Q |
111 |
gattctttcttgaggatggcggaa |
134 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35004108 |
gattctttcttgaggatggcggaa |
35004131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 133 - 233
Target Start/End: Original strand, 35004228 - 35004328
Alignment:
| Q |
133 |
aacgttgtctccactgtatgcttagtagtcttcccttcaaataccttgggttagcggtgggggctaatcctcgttctgccagaacctgggaacctttagt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35004228 |
aacgttgtctccactgtatgcttagtagtcttcccttcaaataccttgggttagcggtgggggctaatcctcgttctgccagaacctgggaacctttagt |
35004327 |
T |
|
| Q |
233 |
c |
233 |
Q |
| |
|
| |
|
|
| T |
35004328 |
c |
35004328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 43579 - 43483
Alignment:
| Q |
17 |
gtggactatcaataccatcctccgttgttttgagcttgccttgggtctcagggttaattttgctaaaagttgtttaatggggatccatgtggaagatt |
114 |
Q |
| |
|
||||||||| || || |||||||||||||||||| |||||| ||| ||| ||||||||||||||| |||||| || |||| | ||||||||| |||| |
|
|
| T |
43579 |
gtggactatgaagactatcctccgttgttttgagtttgcctcgggcttca-ggttaattttgctaagagttgtctagtgggaacccatgtggatgatt |
43483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University