View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12275_low_6 (Length: 314)
Name: NF12275_low_6
Description: NF12275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12275_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 14 - 206
Target Start/End: Complemental strand, 4284553 - 4284361
Alignment:
| Q |
14 |
gttcactggttttacagttgaaacttggaatgcttcattccttcgagaatttgcagttccaaacctaaattttttctcagtaacaatcaaatcaaattcg |
113 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4284553 |
gttcactggttttgcagttgaaacttggaatgcttcattccttcgagaatttgcagttcaaaacctaaattttttctcagtaataatcaaatcaaattcg |
4284454 |
T |
|
| Q |
114 |
aacttcttcaatttgcatccattattattcatcaatggttcttcaattccacgaacacataatcacagagcttctagaagacaccaatggcgg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4284453 |
aacttcttcaatttgcatccattattattcatcaatggttcttcaattccacgaacacataatcacagagcttctagaagacaccaatggcgg |
4284361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 146 - 202
Target Start/End: Complemental strand, 23429478 - 23429422
Alignment:
| Q |
146 |
caatggttcttcaattccacgaacacataatcacagagcttctagaagacaccaatg |
202 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| | ||||||||||||||||||| |
|
|
| T |
23429478 |
caatggttcttcaattccacacaaacataatcacttaacttctagaagacaccaatg |
23429422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University