View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12276_high_14 (Length: 230)
Name: NF12276_high_14
Description: NF12276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12276_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 219
Target Start/End: Original strand, 53042790 - 53042991
Alignment:
| Q |
18 |
gttgaagctgaagaacataagacacggttgtttgtctgcaaagggaaacatgttgtgtatgtcaaagaggcaagtttgatattattcccctgttattgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53042790 |
gttgaagctgaagaacataagacacggttgtttgtctgcaaagggaaacatgttgtgtatgtcaaagaggcaagtttgatattattcccctgttattgat |
53042889 |
T |
 |
| Q |
118 |
tcattaaggtttgagacttgcacattattagtatagacaatcacacatatataaacgctagtttctaccttttgattaaatatttatattggtcacaggt |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
53042890 |
tcattgaggtttgagacttgcacattattagtatagacaatcacacatatataaacgctagtttctaccttttgattaaatatttatattggttataggt |
53042989 |
T |
 |
| Q |
218 |
tc |
219 |
Q |
| |
|
|| |
|
|
| T |
53042990 |
tc |
53042991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 24 - 94
Target Start/End: Complemental strand, 15965093 - 15965023
Alignment:
| Q |
24 |
gctgaagaacataagacacggttgtttgtctgcaaagggaaacatgttgtgtatgtcaaagaggcaagttt |
94 |
Q |
| |
|
|||||| |||| ||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15965093 |
gctgaaaaacacaagacacggttgtttgtatgcagagggaaacatgttgtacatgtcaaagaggcaagttt |
15965023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University