View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12276_low_12 (Length: 249)
Name: NF12276_low_12
Description: NF12276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12276_low_12 |
 |  |
|
| [»] chr1 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 100 - 249
Target Start/End: Complemental strand, 26500392 - 26500243
Alignment:
| Q |
100 |
ttatccaaatctgcatacaatggattgctcctttagagagtgtcataattatgtatgcaacaatccatatacannnnnnnnggcttcttatgcatgacag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||| |||||| |
|
|
| T |
26500392 |
ttatccaaatctgcatacaatggattgctcctttagagagtgtcatagttatgtatgcaacaatccatatacattttttttggctacttatgcctgacag |
26500293 |
T |
 |
| Q |
200 |
attgcagataaatcaacgaaagagtaaaatgagccttggcaatccttatt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26500292 |
attgcagataaatcaacgaaagagtaaaatgagtcttggcaatccttatt |
26500243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 32 - 132
Target Start/End: Complemental strand, 26491326 - 26491226
Alignment:
| Q |
32 |
taagcaccacctcttcatgaacccaaaccaaatttgcaagaaatttcttatgctcattaggaactgccttatccaaatctgcatacaatggattgctcct |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
26491326 |
taagcaccacctcttcatgaacccaaaccaaatttgcaagaaatttcttatgctcatcaggaactgccttatccaaatctgcgtacaaaggattgctcct |
26491227 |
T |
 |
| Q |
132 |
t |
132 |
Q |
| |
|
| |
|
|
| T |
26491226 |
t |
26491226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 40 - 132
Target Start/End: Complemental strand, 26503755 - 26503663
Alignment:
| Q |
40 |
acctcttcatgaacccaaaccaaatttgcaagaaatttcttatgctcattaggaactgccttatccaaatctgcatacaatggattgctcctt |
132 |
Q |
| |
|
||||||||||| |||||||||||||| || ||||||||||||||||||| ||||||||||||| |||||||||||| ||||| | |||||||| |
|
|
| T |
26503755 |
acctcttcatgcacccaaaccaaattcgcgagaaatttcttatgctcatcaggaactgccttaaccaaatctgcatgcaatgaactgctcctt |
26503663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 32 - 77
Target Start/End: Complemental strand, 26488006 - 26487961
Alignment:
| Q |
32 |
taagcaccacctcttcatgaacccaaaccaaatttgcaagaaattt |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26488006 |
taagcaccacctcttcatgaacccaaaccaaatttgcgagaaattt |
26487961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University