View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12276_low_17 (Length: 214)
Name: NF12276_low_17
Description: NF12276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12276_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 204
Target Start/End: Original strand, 2787836 - 2788020
Alignment:
| Q |
20 |
ccagcatcaacccaaccgaaccggctctacgtgcattctgccacgtcgcatggcttaactagcaatgacacaaataagctcattggagggttacctcaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787836 |
ccagcatcaacccaaccgaaccggctctacgtgcattctgccacgtcgcatggcttaactagcaatgacacaaataagctcattggagggttacctcaaa |
2787935 |
T |
|
| Q |
120 |
agaccatatttgattctttggacgaaaatggtttcaattttgggatctattatcaacaaccaccatccacccttttccacaggtt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2787936 |
agaccatatttgattctttggacgaaaatggtttcaattttgggatctattatcaacaaccaccatccacccttttctacaggtt |
2788020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 24 - 204
Target Start/End: Original strand, 7362935 - 7363116
Alignment:
| Q |
24 |
catcaacccaacc-gaaccggctctacgtgcattctgccacgtcgcatggcttaactagcaatgacacaaataagctcattggagggttacctcaaaaga |
122 |
Q |
| |
|
||||||||||| | |||||| ||||| ||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||| | |
|
|
| T |
7362935 |
catcaacccaaactgaaccgactctatgtgcattctgcgacgtcacatggcttaactagcaatgacacaaataagctcattgggggattacctcaaaata |
7363034 |
T |
|
| Q |
123 |
ccatatttgattctttggacgaaaatggtttcaattttgggatctattatcaacaaccaccatccacccttttccacaggtt |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7363035 |
ccatatttgattctttagacgaaaatggtttcaattttgggatctattatcaacaaccaccatccacccttttctacaggtt |
7363116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University