View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12277_low_5 (Length: 241)
Name: NF12277_low_5
Description: NF12277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12277_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 1201010 - 1200791
Alignment:
| Q |
1 |
aatttaggagaagtatggcatgatgaccgtattagtatgtctcgtgttctaccaaaaccaaaaccaaggtaagttatttctttcaaacgcaaagaatcac |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1201010 |
aatttaggagaagtatggcacgatgaccgtattaatatgtctcgtgttctaccaaaaccaa------ggtaagttatttctttcaaacgcaaagaatcac |
1200917 |
T |
|
| Q |
101 |
agaaagaaatacaagagaagttgataccctcataaggcatgcgaatgtcacgttgaatgaaaatgctttgaagtagaggtgcaattataaagacagcaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1200916 |
agaaagaaatacaagagaagttgataccctcataaggcatgcaaatgtcacgttgaatgaaaatgctttgaagtagaggtgcaattataaagacagcaga |
1200817 |
T |
|
| Q |
201 |
ttcttttagaaaccaatcacagtttt |
226 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
1200816 |
ttctttaagaaaccaatcacagtttt |
1200791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 68 - 191
Target Start/End: Complemental strand, 1204120 - 1203997
Alignment:
| Q |
68 |
ggtaagttatttctttcaaacgcaaagaatcacagaaagaaatacaagagaagttgataccctcataaggcatgcgaatgtcacgttgaatgaaaatgct |
167 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||| ||||||||| ||||| | | | |||||||| ||||||||||| ||||||||||||| |
|
|
| T |
1204120 |
ggtaagttatttctttcaaatgcaaagaatcacaaaaagagatacaagagtagttgggatcattataaggcacatgaatgtcacgtcgaatgaaaatgct |
1204021 |
T |
|
| Q |
168 |
ttgaagtagaggtgcaattataaa |
191 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
1204020 |
ttgaagtagaggcgcaattataaa |
1203997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University