View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12278_high_2 (Length: 337)
Name: NF12278_high_2
Description: NF12278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12278_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 322
Target Start/End: Original strand, 40117041 - 40117345
Alignment:
| Q |
18 |
gtttcgtttcgtgtgaactttcgcatttgatcaaggtgcattgtatgtctcttgttctgtcctcccaattctcgagtgtttttcgcaacttctcgatgag |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40117041 |
gtttcgtttcgtgtgaactttcgcagttgatcaaggtgcattgtatgtctcttgttttgtcctcccaattctcgagtgtttttcgcaacttctcgatgag |
40117140 |
T |
 |
| Q |
118 |
atcatgattcgtggcgagttcttgattgtttctcaatgttgctagatcatgannnnnnnnnnnnnncgatcgtaattctaagtttgtgtatgattcagat |
217 |
Q |
| |
|
| |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
40117141 |
accatgattcatggcgagttcttgattgtttctcaatgttgctagatcatgatttttggtttttttcgatcgtaattctaagtttatgtatgattcagat |
40117240 |
T |
 |
| Q |
218 |
tctcgtgaccaagattcatgctcgctcatgattgttttgttcttgcttgaaattcataactttttatcttattttggtgtttaatggtaaatttggctag |
317 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40117241 |
tctcgtgaccaagattcatgctcgttcatgattgttttgttcttgcttggaattcataactttttatcttattttggtatttaatggtaaatttggctag |
40117340 |
T |
 |
| Q |
318 |
tgcac |
322 |
Q |
| |
|
||||| |
|
|
| T |
40117341 |
tgcac |
40117345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University