View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12278_low_3 (Length: 253)
Name: NF12278_low_3
Description: NF12278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12278_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 176 - 236
Target Start/End: Original strand, 23234273 - 23234333
Alignment:
| Q |
176 |
taatgactgggataagatttgaagcaaactttatgaaatttgtacaacaactagcaggcac |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23234273 |
taatgactgggataagatttgaagcaaacattatgaaatttgtacaacaactagcaggcac |
23234333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 58 - 105
Target Start/End: Original strand, 23234004 - 23234051
Alignment:
| Q |
58 |
atataccattatagaatcatctatttcatgttatgagtgcacatatta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23234004 |
atataccattatagaatcatctatttcatgttctgagtgcacatatta |
23234051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 58
Target Start/End: Complemental strand, 13457705 - 13457667
Alignment:
| Q |
20 |
taactgaaaatactaaggaatactaaggcaattcctaca |
58 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
13457705 |
taactgaaaatactaaggaatactaagtcaatttctaca |
13457667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University