View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12279_high_1 (Length: 322)
Name: NF12279_high_1
Description: NF12279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12279_high_1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 107 - 322
Target Start/End: Complemental strand, 24041706 - 24041491
Alignment:
| Q |
107 |
acatcaggttagggtatagattgggatctttctttattcagaatagttacatgtatgaattttgctcaagattctttaattaacattggggattattatt |
206 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
24041706 |
acattaggttagagtatagattgggatctttctttattaagaatagttacatgtatgaattttgttcaagattctttaattaatattggggattattatt |
24041607 |
T |
|
| Q |
207 |
ttgaatgttaggttccaagacaccaatgaaagtgtaagtcccaactctagggaaccataccaacgtctcacgtataacggtcatgtgagctgcatttgtg |
306 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24041606 |
ttgaatgttaggttccaagaaacctatgaaagtgtaagtctccactctagggaaccataccaacgtctcacgtataacggtcatgtgagccacatttgtg |
24041507 |
T |
|
| Q |
307 |
cgggaatacctccctt |
322 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
24041506 |
cgggaatacctccctt |
24041491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University