View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12280_high_11 (Length: 235)
Name: NF12280_high_11
Description: NF12280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12280_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 217
Target Start/End: Complemental strand, 7009180 - 7008978
Alignment:
| Q |
15 |
cagagaccattcgtggtaacaataccatagtgtctctggccatcgcttcctgtgtaactgtcagtgaaggaagtaaaagcacagttgaaaccacaaatga |
114 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7009180 |
cagagaccattcatggtaacaataccatagtgtctctggccatcgcttccggtgtaactgtcagtgaaggaagtaaaagcacagttgaaaccacaaatga |
7009081 |
T |
 |
| Q |
115 |
cgaggagaataccacttaggtatttgttgatggtgctgcagtgtccattgttggttacaactggactgagatactggaacaagaagaccgtgccggtagg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7009080 |
cgaggagaataccacttaggtatttgttgatggtgctgcagtgtccattgttggttacaactggactgagatactggaacaagaagaccgtgccggtagg |
7008981 |
T |
 |
| Q |
215 |
aag |
217 |
Q |
| |
|
||| |
|
|
| T |
7008980 |
aag |
7008978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University