View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12280_low_11 (Length: 243)
Name: NF12280_low_11
Description: NF12280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12280_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 39084169 - 39084391
Alignment:
| Q |
1 |
aaggaagaggtgatggaggagaagggagagagacatgatttttcggagaatttgccggaaataatggaagggagaccagattatttgaataggcagattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39084169 |
aaggaagaggtgatggaggagaagggagagagacatgatttttcggagaatttgccggaaataatggaagggagaccagattatttgaataggcagattt |
39084268 |
T |
 |
| Q |
101 |
cagggaaagggtggaagcctagcttggatactattaaggagaagaatattgagaaaaaacatactcattggttgttcctcaagagtttttagtggtatag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39084269 |
cagggaaagggtggaagcctagcttggatactattaaggagaagaatattgagaaaaaacatactcattggttgttcctcaagagtttttagtggtatag |
39084368 |
T |
 |
| Q |
201 |
ttattttagttttggttagtagt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39084369 |
ttattttagttttggttagtagt |
39084391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 83 - 146
Target Start/End: Complemental strand, 44729815 - 44729752
Alignment:
| Q |
83 |
atttgaataggcagatttcagggaaagggtggaagcctagcttggatactattaaggagaagaa |
146 |
Q |
| |
|
|||||| |||||| | |||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
44729815 |
atttgagtaggcaattatcagggaaagggtggaagcctagcttggatacaattaaggaaaagaa |
44729752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University