View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12280_low_4 (Length: 388)
Name: NF12280_low_4
Description: NF12280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12280_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 21 - 331
Target Start/End: Complemental strand, 21120932 - 21120622
Alignment:
| Q |
21 |
aaagttacagttatggtaccttcttagtacgggttctaatctcggatttacgagctttgttgtaaacgcgacgcctctcagcctgaagagctttcttaat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21120932 |
aaagttacagttatggtaccttcttagtacgggttctaatctcggatttacgagctttgttgtaaacgcgacgcctctcagcctgaagagctttcttaat |
21120833 |
T |
 |
| Q |
121 |
ggcggaatcaaccttctttggagcagcctcgcaaacaacaacaacaccacgcctctggaccgtattcaaagagaacgtaccttgtgaaaggactctagat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21120832 |
ggcggaatcaaccttctttggagcagcctcgcaaacaacaacaacaccacgcctctggaccgtattcaaagagaacgtaccttgtgaaaggactctagat |
21120733 |
T |
 |
| Q |
221 |
tgggaaatgtttcgggagaaacttagtgaaccggaatttgatgatgaagttagggtaaggttcttcattttcgaaggaaggttcaacaatgaacatgaaa |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21120732 |
tgggaaatgtttcgggagaaacttagtgaaccggaatttgatgatgaagttagggtaaggttcttcattttcgaaggaaggttcaacaatgaacatgaaa |
21120633 |
T |
 |
| Q |
321 |
ctgaagccata |
331 |
Q |
| |
|
||||||||||| |
|
|
| T |
21120632 |
ctgaagccata |
21120622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University