View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12281_high_2 (Length: 205)
Name: NF12281_high_2
Description: NF12281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12281_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 27984070 - 27983883
Alignment:
| Q |
1 |
ggaatggaaaccatggcggatgttggtggtggcttgcatagggcgagatgtagaagcgacgcgaaaggaatagagtcatggatagatgtgtaaggaagcc |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
27984070 |
ggaatggaaaccatggcggatattggtggtggcttgcatagggcgagatgtagaagcgacgcgaaaggaatggagttatggatagatgtgtaaggaagcc |
27983971 |
T |
|
| Q |
101 |
tacatggggttcgggatcatgttgcttcattagggaggttgaaacccnnnnnnnnttaaaagagagttctaaaggcattgttctccct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27983970 |
tacatggggttcgggatcatgttgcttcattagggaggttgaaaccctaaaaaaattaaaagagagttctaaaggcattgttctccct |
27983883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University