View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12281_high_2 (Length: 205)

Name: NF12281_high_2
Description: NF12281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12281_high_2
NF12281_high_2
[»] chr1 (1 HSPs)
chr1 (1-188)||(27983883-27984070)


Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 27984070 - 27983883
Alignment:
1 ggaatggaaaccatggcggatgttggtggtggcttgcatagggcgagatgtagaagcgacgcgaaaggaatagagtcatggatagatgtgtaaggaagcc 100  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||    
27984070 ggaatggaaaccatggcggatattggtggtggcttgcatagggcgagatgtagaagcgacgcgaaaggaatggagttatggatagatgtgtaaggaagcc 27983971  T
101 tacatggggttcgggatcatgttgcttcattagggaggttgaaacccnnnnnnnnttaaaagagagttctaaaggcattgttctccct 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||    
27983970 tacatggggttcgggatcatgttgcttcattagggaggttgaaaccctaaaaaaattaaaagagagttctaaaggcattgttctccct 27983883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University