View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12282_high_3 (Length: 231)
Name: NF12282_high_3
Description: NF12282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12282_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 29145024 - 29145236
Alignment:
| Q |
1 |
gctcagcgacacaacttttttagatggctcttcagattatgattctagcttggtattaactaaggttgattataaaaaggatcaagttgttggtcaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29145024 |
gctcagcgacacaacttttttagatggctcttcagattatgattctagcttggtattaactaaggttgatgataaaaaggatcaagttgttggtcaaaat |
29145123 |
T |
 |
| Q |
101 |
gaagccaaccctgcatcgaaatcgagttcctcaagccaggttagttttcttttctcgtagcatcgacactttaaattgaaggtgtgtctagtatatatcc |
200 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
29145124 |
gaagccaaccctgcatcgaaatcgggctcctcaagccaggttagttttcttttctcgtagcatcaacactttaaattgaaggtgtgtctag----tatcc |
29145219 |
T |
 |
| Q |
201 |
aacacatgtcggacaca |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
29145220 |
aacacatgtcggacaca |
29145236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University