View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12283_low_2 (Length: 337)
Name: NF12283_low_2
Description: NF12283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12283_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 39 - 221
Target Start/End: Original strand, 9233758 - 9233933
Alignment:
| Q |
39 |
ttcattggatcccgattaggtttatttttgttggttcacattctcatatggtaaatgtggagaatggtaaatattactacccacgtgcaactcggtgtca |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9233758 |
ttcattggatcccgattaggtttatttttgttggttcacattctcatatcgtaaatgtggagaatggtaaatattactacccacgtgcaactcggtgtca |
9233857 |
T |
|
| Q |
139 |
ttgtattgattatggaaaataattttaacgatgtgtctcttacaagttacaaccatcgttcaacttcttattcaaattaatga |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9233858 |
ttgtattgattatggaaaataattttaacgatgtgtctc-------ttacaaccatcgttcgacttcttattcaaattaatga |
9233933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 215 - 323
Target Start/End: Original strand, 9233960 - 9234055
Alignment:
| Q |
215 |
ttaatgaacccagaggcattccaagtttaggcttaatagcatgattgtgaatattggacgtgaataagggaaaaatttgtttgtttcacaccaacttttg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
9233960 |
ttaatgaacccagaggcattccaagtttaggcttaatagcatgatt-------------gtgaataacggaaaaatttgtttgtgtcacaccaacttttg |
9234046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University