View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12283_low_6 (Length: 209)
Name: NF12283_low_6
Description: NF12283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12283_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 20 - 193
Target Start/End: Original strand, 5286239 - 5286412
Alignment:
| Q |
20 |
cagttgtcttgctattaatattatttcgttttctggggactacatagtacgtatgatgcagttttttctgtaacaagttaccttgctgctgccttttgaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5286239 |
cagttgtcttgctattaatattatttcgttttctggggactacgtagtacgtatgatgcagtttttttcgtaacaagttaccttgctgctgccttttgaa |
5286338 |
T |
|
| Q |
120 |
ccgtggcatttttatgattatattaaggaaaatatatcagctatctctatgcatacaaactggttttcataaca |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5286339 |
ccgtggcatttttatgattatattaaggaaaatatatcagctatctctatgcatacaaactggttttcataaca |
5286412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University