View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12284_low_2 (Length: 396)
Name: NF12284_low_2
Description: NF12284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12284_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 155 - 379
Target Start/End: Complemental strand, 7332490 - 7332266
Alignment:
| Q |
155 |
acaattgccgatgaacgagttgactcagcttgataatcttgatgaagnnnnnnnngagaaacaattgatgatgatgacggttgctaaggcggatcaaatt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7332490 |
acaattgccgatgaacgagttgactcagcttgataatcttgatgaagaagaaaaagagaaacaattgatgatgatgacggttgctaaggcggatcaaatt |
7332391 |
T |
|
| Q |
255 |
ttggtggatgttcagtttctgaaagggaaattggaaactattaatgatttatctcaaatgcaaattctggaggataaaacgaagtgtctcaaaagctttc |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7332390 |
ttggtggatgttcagtttctgaaagggaaattggaaactattaataatttatctcaaatgcaaattctggaggataaaacgaagtgtctcaaaagctttc |
7332291 |
T |
|
| Q |
355 |
tgaaggtttatctcaagtcaacaac |
379 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7332290 |
tgaaggtttatctcaagtcaacaac |
7332266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 312 - 379
Target Start/End: Complemental strand, 7322980 - 7322913
Alignment:
| Q |
312 |
atgcaaattctggaggataaaacgaagtgtctcaaaagctttctgaaggtttatctcaagtcaacaac |
379 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| |||||||||| |||||| |||||| |||| |
|
|
| T |
7322980 |
atgcaaattctggaggatagattgaagtgtctcaaaatctttctgaagatttatcgtaagtcagcaac |
7322913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University