View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12284_low_4 (Length: 280)
Name: NF12284_low_4
Description: NF12284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12284_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 262
Target Start/End: Complemental strand, 32258341 - 32258094
Alignment:
| Q |
17 |
gagatgaagcatagggaggctgtatgggataaacaagttaaattgtttcagcttgcagatattctgatatgaatatgaaactctct--gaattataagtt |
114 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32258341 |
gagatgaagcacagggaggctgtatggggtaaactagttaaattgtttcagcttgcagatattctgatatgaatatgaaactctctctgaattataagtt |
32258242 |
T |
 |
| Q |
115 |
cagagcaaaacataaagtacaatgctttatagaagcaatggataattctatactgcttgcttaataatctttgctatattctacctagcggactcagtat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32258241 |
cagagcaaaacataaagtacaatgctttatagaagcaatggataattctatactgcttgcttaataatctttgctatattctacctagcggattcagtat |
32258142 |
T |
 |
| Q |
215 |
gtatgtttaatctagtttactcgttagagattttataatctgaaatgt |
262 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32258141 |
gtatgtttaatctattttactcgttagagattttataatctgaaatgt |
32258094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University