View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12286_high_3 (Length: 237)
Name: NF12286_high_3
Description: NF12286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12286_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 16 - 219
Target Start/End: Original strand, 24639026 - 24639229
Alignment:
| Q |
16 |
agcaaagggcaaatgaaaaacacattaaccaataaccagcaaaagaaatgaagaagtttgaacctaatgtagtagctcaaacaatggctctttaaccgct |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||| |||||| ||||||||| || |
|
|
| T |
24639026 |
agcaaaaggcaaatgaaaaacacattaacgaataaccagcaaaagaaatgaagaagtttgaacctgatgatctagctcaagcaatggttctttaacctct |
24639125 |
T |
 |
| Q |
116 |
gttgaatgagctgatagggttgtgagagcaccagtactacgattgccgattagtgcggtgatttagcagacgaagtctcggcgggcggaatcgcctactc |
215 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
24639126 |
gctgaatgagctgatagggttgtgagagcaccggtactacgattgccgattggtgcggtgatttagcagacgaagtctcggcggccggaatcgccttctc |
24639225 |
T |
 |
| Q |
216 |
ttgt |
219 |
Q |
| |
|
|||| |
|
|
| T |
24639226 |
ttgt |
24639229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University