View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1228_high_24 (Length: 252)
Name: NF1228_high_24
Description: NF1228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1228_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 30 - 159
Target Start/End: Complemental strand, 2034999 - 2034870
Alignment:
| Q |
30 |
tttagaggtctctgcaacggtattgtaactgcaaatgtggcttcattggctgcatttttctgcaaatgcaatttagaaccatgcttcttacattcagttc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2034999 |
tttagaggtctctgcaacggtattgtaactgcaaatgtggcttcattggctgcatttttctgcaaatgcaatttagaaccatgcttcttacattcagttc |
2034900 |
T |
 |
| Q |
130 |
ctgatgtttacttaaaggagaatcagaatc |
159 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
2034899 |
ctgatgtttacttaaaggagaatcggaatc |
2034870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University