View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1228_high_24 (Length: 252)

Name: NF1228_high_24
Description: NF1228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1228_high_24
NF1228_high_24
[»] chr7 (1 HSPs)
chr7 (30-159)||(2034870-2034999)


Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 30 - 159
Target Start/End: Complemental strand, 2034999 - 2034870
Alignment:
30 tttagaggtctctgcaacggtattgtaactgcaaatgtggcttcattggctgcatttttctgcaaatgcaatttagaaccatgcttcttacattcagttc 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2034999 tttagaggtctctgcaacggtattgtaactgcaaatgtggcttcattggctgcatttttctgcaaatgcaatttagaaccatgcttcttacattcagttc 2034900  T
130 ctgatgtttacttaaaggagaatcagaatc 159  Q
    |||||||||||||||||||||||| |||||    
2034899 ctgatgtttacttaaaggagaatcggaatc 2034870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University